"Animals evolve after natural selection and adapt into special monster." I think you intended for it to say monsters, unless I did it incorrectly. However, I think the professor said we could only alter the verbs. I might be wrong. Let me know.
As long as the base words are the same, there is a lot of flexibility allowed in suffix additions.
Thanks for the clarification. I was a little confused about it myself in creating a sentence. I just hope I translated it right.
Yea you translated it right. I did mean monsters, i just forgot about the suffix addition rules. But yes you translated it correctly. Good job!
This is the mRNA strand for my sentence:AUGAAUCGAUGCGGGUCACGGUCCGGAACCUAG
"Animals evolve after natural selection and adapt into special monster."
ReplyDeleteI think you intended for it to say monsters, unless I did it incorrectly. However, I think the professor said we could only alter the verbs. I might be wrong. Let me know.
As long as the base words are the same, there is a lot of flexibility allowed in suffix additions.
ReplyDeleteThanks for the clarification. I was a little confused about it myself in creating a sentence. I just hope I translated it right.
ReplyDeleteYea you translated it right. I did mean monsters, i just forgot about the suffix addition rules. But yes you translated it correctly. Good job!
ReplyDeleteThis is the mRNA strand for my sentence:
ReplyDeleteAUGAAUCGAUGCGGGUCACGGUCCGGAACCUAG